Your Father’s Father


Deep Into DNA
a monthly column by Mike Maglio

Raise your hand if you’d like to know more about your surname and your father’s ancestry. I’m raising mine!

Most of us live in a patrilineal society. The wife and the children take the surname of the husband. We can’t help but to associate with our father’s family, his clan. The males in the family will inherit the Y chromosome virtually unchanged, though genetically, we can only attribute a small fraction of our overall DNA to that patrilineal line. Psychologically though, 50% of our ethnic identity comes from dad.

 

We have all tried traditional genealogy for our father’s line. Some of us go back a couple of generations and some of us have researched a dozen generations. A few of us are adopted and know nothing about our paternity. Y-DNA testing has benefits that aid a genealogist in all these situations.

 

What is Y-DNA testing? We all have 46 chromosomes that define our traits and explain why we look like our parents. We get 23 from mom and 23 from dad. Forty-four of those chromosomes are called autosomes and I’ll talk more about them in a future column. The two remaining chromosomes are the sex chromosomes – X&Y for men and X&X for women. Y-DNA testing analyzes the Y chromosome and is a male only test.

 

Your DNA analysis looks like this – ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCT – only longer. In the Y-DNA, scientists have identified markers, signposts along the string that are unique in that they repeat. The number of times that the section repeats is its marker value. These are called STRs or short tandem repeats. There are over 100 of these markers that can be tested. Typical tests look at 12, 25, 37, 67 or 111 or these markers. All the markers combined into one record becomes your haplotype, a genetic fingerprint of your male line.

 

The following set of six markers - DYS388 = 12, DYS390 = 24, DYS391 = 11, DYS392 = 13, DYS393 = 13 and DYS394 = 14, defines the haplotype of an average man from Western Europe. Six to twelve markers are enough to determine your ancient origins and 111 markers can confirm a relationship within the last four generations. The number of markers that you test is dependent on the genealogical question you want to answer.

 

No matter how many markers you test, as a minimum you will learn about your world origins, your haplogroup. There are roughly fifteen world Y-DNA haplogroups designated A through T. Each haplogroup has an approximate geographic origin and ethnic identity. A haplogroup can be defined as a tribe of people with a unique mutation in their haplotype. There are additional mutations that can define subgroups within a haplogroup. Each of these mutations are called a SNP, a single nucleotide polymorphism. Only a SNP test can confirm that you belong to a subgroup. However, if your haplotype matches someone that has been SNP tested, then you can assume that you have the same subgroup.

 

For example, haplogroup R1b is a subgroup of R and has an origin of Central Asia. Each letter or number in a subgroup designation indicates a SNP mutation – R (M207), R1 (M173), R1b (M343). R1b men are the largest group in Europe and are ethnically associated as Celtic, Iberian or Gallic. The results of a recent study that came as a surprise shows that Egyptian pharaoh Tutankhamen’s male ancestors were haplogroup R1b from Europe. Haplogroups E and J are much more common in that region.

 

If you already have a significant traditional genealogy for your paternal line with a dozen generations, you can use Y-DNA to confirm your research. A typical US genealogy attempts to go back to the original immigrant or immigrant family. Genealogists researching the same common ancestor may form a surname group or society. Many of these groups already have DNA projects running with many participants. Compare your DNA to the DNA of two or more parallel family lines, the results can prove or disprove your research. In the event that a DNA project doesn’t exist for your surname, you can start one and invite other genealogists to join.

 

You might only have a few generations documented and now you are stuck behind a brick wall. Y-DNA can open new avenues of research by putting you in touch with genetic cousins. After testing, you will find Y-DNA matches that have the potential of taking you around your brick wall. If your genetic cousin has researched further back in time to a common ancestor, then you could work forward in time from there to make the connection to your line.

 

Perhaps there was an event in your paternal line where a son didn’t have the same surname as his biological father. Adoption, illegitimacy or the assumption of an alias can all account for a non-paternal event. If you have been living as John Smith your whole life, matches in the Y-DNA databases have the possibility of revealing your true surname. With the help of your newfound cousins, you could track down the details of your surname change. With a 111 marker Y-DNA test you could get within four generations of the event.

 

Y-DNA tests are not inexpensive. They range from $100 to $400. You may want to start with a middle of the road test – 37 markers. If you receive many exact matches on 37 markers, then you have the option of upgrading your test to 67 or 111, in order to refine your genetic relationship. If you have no exact matches on 37 markers, then upgrading will not improve your chances. In time, more records will be added to the databases and your testing company will send you an email if you get a new match.

 

You don’t have to settle for just your father’s line, you could also test your mother’s father. If he is no longer alive, you could test your mother’s brother or your mother’s brother’s son. You may be able to find a male descendant to test for every surname in your tree. Think about collecting DNA samples from the older generations in your family.

 

As far as DNA tests go, I don’t like to pick favorites. Use a top laboratory, even if it costs a bit more. As they say – “You get what you pay for.” If there were several top Y-DNA testing options, I’d write about them. Family Tree DNA is by far the world leader. They have the largest database of results and the best selection of quality tests.

 

Don’t let the results overwhelm you. As genealogists, we are used to tracking volumes of data, names, dates and locations. Y-DNA results are just another piece of data and many of the best genealogy software products allow you to add your DNA results to your family records.

 

Whatever your reasons may be, finding your deep ancestral origins, verifying your traditional genealogy, breaking through brick walls or getting the story behind your non-paternal event, Y-DNA is a great tool to add to your research kit. Y-DNA can be least expensive of the DNA tests and has the greatest number of benefits.

 

Mike Maglio is the author of Deep into DNA, a monthly column in The In-Depth Genealogist which focuses on the use of DNA in genealogical research. Mike can be found blogging at OriginHunters.

© Mike Maglio 2012

This article originally appeared in the August 2012 issue of The In-Depth Genealogist. Receive The In-Depth Genealogist free by subscribing HERE.